rhett45 rhett45
  • 25-02-2021
  • Mathematics
contestada

You randomly draw a marble from a bag of marbles that contains 8 blue
marbles, 11 green marbles, and 8 red marbles.
What is P(draw a blue or a red marble)?
If necessary, round your answer to 2 decimal places?

Respuesta :

petscop
petscop petscop
  • 25-02-2021

Answer:

.

Step-by-step explanation:

Answer Link

Otras preguntas

What would you see if you were to place a screen at the point of an image formed by a plane mirror? No image would be formed on the screen. A smaller vers
What’s the term bias
4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
Help finding mean of data set A and data set B?
In the late 1800 hiw did the federal government respond to the southerners attempts to limit African American voting
In circle o, a diameter has endpoints (-5,4) and (3,-6). What is the length of the diameter?
What is the answer please?
What are the three sources of solid waste
find the length of the missing side
How many different pairings (2 teams playing each other) are possible for the first round of the 64 teams in the NCAA Basketball Tournament? (without seeding)