helenirby1964 helenirby1964
  • 22-05-2020
  • Chemistry
contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof
  • 22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

The proclamation act of 1763:
what is 62÷378 with the remainder
write an equation for the line with x-intercept 5 and y-intercept 3.
The process in india whereby an entire caste can leapfrog over another and obtain a higher position in the hierarchy is called: sanskritization. vaishya caste.
What is −3 1/3 divide by 9 a.−10/27 b.−1/9 c.1/9 d.10/27?
What was shipped from the British colonies to Africa?
Implied A. Explicit B. Implicit C. Marketable D. Embargo
The goals of the american revolution were most influenced bya. the enlightenment and the french revolution b. the glorious revolution and the enlightenment c.
the square root of 105 is between which two integers?
In my exhaustion, in my overwhelming exhaustion, I forgot all other obligations and went to sleep. What type of rhetorical device is used in the above example?