croitru7857 croitru7857

25-02-2018
Biology

contestada

The base sequence of the template strand of dna is cattggtaggcaaaagaact. what is the new synthesized complementary strand?

Respuesta :

Eric0422 Eric0422

25-02-2018

gtaaccatccgttttcttga

Answer Link

Otras preguntas

Compute the weekly wages for the times given assuming a 40 hour week with time and a half for all overtime. Hourly wage: 10.50 and hours: 38 what is the total p

What dangers did ibn battuta experience on his journey across the desert and how did he avoid them

Why were there so many strikes during the 1800s?

A constitutional monarchy, indirect democracy, and parliamentary republic can all be considered "representative governments" because

the ratio of boys to girls in history class is 4 to5. how many girls are in the class if therebare 12 boys in the class?

A human lung at maximum capacity has a volume of 3.0 liters. If the partial pressure of oxygen in the air is 21.1 kilopascals and the air temperature is 295 K,

Which of the following is written as a rational function? A.G(x)=-2x B.P(x)=3x+4 C.Q(x)=x^2-8x+1 D.F(x)=x+2/5x

A metal atom loses electrons from its outermost energy level and acquires a...... Charge. These electrons join a nonmetal atom. The ionic compound formed becau

HELP ASAP GIVING 20 POINTS AND BRAINLIEST!!!Which point lies on the graph of x=-3? A. (3,2) B. (2,3) C. (-3,-2) D. (-2,-3)

The coordinates of the vertices of ∆PQR are P(-2,5), Q(-1,1), and R(7,3). Determine whether ∆PQR is a right triangle. Show your work and explain your answer!