croitru7857 croitru7857
  • 25-02-2018
  • Biology
contestada

The base sequence of the template strand of dna is cattggtaggcaaaagaact. what is the new synthesized complementary strand?

Respuesta :

Eric0422 Eric0422
  • 25-02-2018
gtaaccatccgttttcttga
Answer Link

Otras preguntas

Prompt How did the Reformation change an artist's life?
Why is page one of the story the importance of being earnest important?
How long will it take for the money in an account that is compounded continuously at 4% interest to sextuple.
Which diagram places the market structures in order from least competitive to most competitive? A. Oligopoly → monopolistic competition → natural monopoly B. Mo
m 2 = aº, m 3 = bº, m 41 a b a + b a-b
Question 7 of 25 Which two chemical equations are balanced? O A. 2PBrg + 3Cl2 - 2PC13 + 3Br2 O B. 2Na+ MgCl2 2NaCl + Mg - C. 2LIOH + 2H2S - Li2S + 2H20 D. 2AgNO
Find the length of y. Assume the triangles are similar.\ A. 3.6 B. 3.2 C. 3.9 D. 3.4
Does this graph show a function? Explain how you know.
Qual o valor da expressão? 155÷2+4−55+1,5−6×5+6?​
A pupil has drawn the electronic structure of fluorine and the diagram is shown below. However, mistakes have been made. State three mistakes that have been mad