terrygoldenfriends terrygoldenfriends

25-03-2024
Geography

contestada

what is the geologic age period of the surface bedrock in kingston

Respuesta :

26willisk 26willisk

25-03-2024

Answer:

The surface bedrock in Kingston belongs to the Ordovician geologic period. This means that the bedrock in Kingston was formed during the Ordovician period, which lasted from around 485 to 443 million years ago.

Explanation:

Answer Link

Otras preguntas

PLEASEE HELP ANSWER!!!!1

Escoge la mejor opción para completar la frase con la forma correcta del verbo estudiar. Choose the best option to complete the sentence with the correct form o

a letter to your friend who was not able to come to your birthday party telling him what happened at the party

what mass of palotassium sulfate will dissolve in 100g of water at 100 degrees

what is the medical name for the collarbone?

Which equation below models this situation? Last week, Tina worked 36 hours in 6 days. She worked the same number of hours each day. How many hours did she work

During the Great Depression: A. many people relied on credit to buy food. B. many people migrated away from their homes. C. many people invested in the stock ma

n 3–5 complete sentences, thoroughly describe a conflict you have faced in your own life and how you changed as a result. Provide at least two specific details

In a market economy, who decides what goods and services will be produced?.

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT