migueltocool123
migueltocool123 migueltocool123
  • 25-04-2017
  • Mathematics
contestada

what is the value of x

what is the value of x class=

Respuesta :

19wohlvic
19wohlvic 19wohlvic
  • 25-04-2017
the first or last answer

Answer Link
Аноним Аноним
  • 25-04-2017
156 is theawnser I believe. I just went through this stuff
Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Hydrogen peroxide decomposes to give water and oxygen gas according to the equation below. If 3.0 moles of hydrogen peroxide decompose, what volume of oxygen ga
john bought a used truck for $4,500 he made an agreement with the dealer to put $1,500 down and mae payments of $350 for the next 10 months the extra cost paid
7) At Elisa's Printing Company LLC there are two kinds of printing presses: Model A which can print 70 books per day and Model B which can print 55 books per da
how to find the average range of cells A1:A10
what is 0+50×1-60×0+10=
Which sentence uses a verb that agrees with its subject? A. The time between Labor Day and Thanksgiving seem short. B. This map of the United States show
What is a vestigial organ
Based on your understanding of sex linkage, describe in detail why most hemophiliacs are male. Can females have hemophilia? Describe how they could inherit this
What do they mean when they say, "Society pays for the end results of alcohol abuse"? Do they mean that the person who consumed it pays the consequences or lite