TabiramuOrigin472
TabiramuOrigin472 TabiramuOrigin472
  • 25-02-2017
  • Mathematics
contestada

A photocopier enlarges the original in the ratio 2:3. The height of a tree is 12 cm on the original. How tall is the tree on the enlarged copy?

Respuesta :

awsmprsn17
awsmprsn17 awsmprsn17
  • 25-02-2017
2/3=12/x
 2*6=12
so 3*6 is 18
that's why x= 18
Answer Link

Otras preguntas

Why does Vivien say that she “shan't tell” Lancelot’s identity to her friend in King Arthur's Socks: A Comedy in One Act?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
The role of media on reporting human rights violation
A single stranded DNA has a base sequence of 5'GACTCCGTAACGGTTAACC3'.What DNA sequence will base pair
which of the following are solutions to the equation below? check all that apply. x^2+6x+9=6 A. x=3+√6 B. x=3-√6 C. x=3 D. x=0 E. x=-3+√6 F. x= -3-√6
What's x² + 2x + 1 factorised?
the surface of water connect like a sort of sort of skin due to property of liquids called
what other fields of the study might contribute to knowledge and understanding in art history?
what happened when citric acid and and bicarbonate soda mixed together
Which department did the US government create immediately after the 9/11 terrorist attacks