janmarsinko313 janmarsinko313
  • 25-08-2022
  • Arts
contestada

After serving in the navy and a brief return to studies at oberlin college, william grant still moved to new york where he ______.

Respuesta :

daifinabl daifinabl
  • 27-08-2022

Answer:

made band arrangements and played in the orchestras of all-black musical shows

Explanation:

Answer Link

Otras preguntas

I Prove that Cos(90-θ)/1+sin(90-θ) +1+sin(90-θ) /cos(90-θ) =2
what is 7/8ths of 40
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
A 54.2 L sample of gas at 115 K is heated to 345 K, at constant pressure. What volume does the gas now occupy?
· Heart muscle receives its oxygen and nutrient supply from o atria o ventricles o aorta o pulmonary veins o coronary arteries · The "cushion" between bones in
Please I need help quickly I'm on a time limit
The majority of people that Muhammad came into contact with were A:Monotheistic B:Polytheistic C:A mixture of both
how to find the average range of cells A1:A10
which branch of central government makes/enact/ passes laws
Make a phrase with each of them for me please 1) Beneficial 2) benefited 3) Breath 4) Brilliant Thank you so much ! Please , no grammars mistakes