stu132057
stu132057 stu132057
  • 26-07-2022
  • Mathematics
contestada

help me please im in a rush

help me please im in a rush class=

Respuesta :

zibahkeshiro
zibahkeshiro zibahkeshiro
  • 26-07-2022

Answer:

The answers are in the image

Step-by-step explanation:

The solutions are in the image

Ver imagen zibahkeshiro
Answer Link

Otras preguntas

Pythagorean Theorem: Alex leaves home, travels 5 miles east, and arrives at the library. He leaves the library and travels 3 miles north to a friend's house.
What hormones are related to sodium balance?
The tube that connects the bladder and the outside is called the
Jonathan has a collection of 400 marbles. Blue marbles make up 17%, percent of his collection. How many blue marbles does Jonathan have?
What is the color of the stars with the lowest surface temperature
if if x+y=10, find the value of y when x=3
This is Super Confusing to me
Explain lt Explain why the formula for finding the surface area of a rectangular prism is helpful. I NEED HELP !
9. There are many more organisms that use double stranded DNA to carry their genetic information than there are organisms that use single stranded DNA to carry
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC