awadadamr awadadamr
  • 25-03-2022
  • Mathematics
contestada

what is the range of the graphhhhhh

what is the range of the graphhhhhh class=

Respuesta :

subtomex0
subtomex0 subtomex0
  • 25-03-2022

y belongs in the interval ]0,∞[

w(t) € ]0,∞[

or

w(t) € {0,∞}

Answer Link

Otras preguntas

What's x² + 2x + 1 factorised?
Sam left his school at 3:05. He walked at a speed of 3.2 mph. 15 minutes later, Al started running after him, and he caught up with Sam 10 minutes later. What w
An essay that uses the words first, next, and finally indicates what type of organization?
Complete the second sentence so that it has a similar meaning to the first sentence. Use the word in bold if given.
How do short-term goals differ from long-term goals?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Discussion the following: Compare and contrast 1. a. Niacin b. Folate c. B12 deficiency d. Riboflavin Thank you
blank thousands = 1800 tens
Elaine bought a total of 15 shirts and pairs of pants. She bought 7 more shirts than pants. How many of each did she buy?
Compared to mitosis, meiosis results in greater... A)amount of cell cytoplasm per cell B)number of daughter cells per cell C)amount of genetic material per cell