NotAlexander NotAlexander

22-02-2022
Mathematics

contestada

look down
Also show your work

"as the teacher say

look down Also show your work as the teacher say class=

Respuesta :

dlasalle28 dlasalle28

22-02-2022

Good Job
And always keep your eyes on ur own paper

Answer Link

AsapLux AsapLux

22-02-2022

Answer:

⅓

Step-by-step explanation:

9:20

15/100: x

CROSS MULTIPLY TO GET

9x= (20 x 15/100 which is equal to 3)

Then get rid of the nine on the other side to get 3/9 which simplifies to ⅓

Answer Link

Otras preguntas

What happens as genes are passed on from parent to offspring over many generations?

Consider the combustion of octane (C8H18) 2C8H18+25O2-> 16CO2+18H2O How many grams of CO2 are produced when 191.6g of octane are burned?

what type of sentence tends to express a strong emotion

one reason President Johnson created the Great Society program was to

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What is 7 3/4 times 7?

· Heart muscle receives its oxygen and nutrient supply from o atria o ventricles o aorta o pulmonary veins o coronary arteries · The "cushion" between bones in

Describe the fluid theory of intelligence; then explain your views on the theory

A common way to deliver anesthesia for surgery and childbirth is to inject the anesthetic agent into the epidural space. A possible complication of this procedu

The radius of the planent venus is nearly the same as that of the earth,but its mass is only eighty percent that of the earth. If an object weighs w on the eart