mgea8108 mgea8108
  • 22-02-2022
  • Spanish
contestada

94759273907293794.049376094707395729073095720753092797490709709707107

Respuesta :

Аноним Аноним
  • 22-02-2022

Answer:

94759273907293794.049376094707395729073095720753092797490709709707107

Explanation:

Answer Link
24nhendrix
24nhendrix 24nhendrix
  • 22-02-2022

Answer:

94759273907293794.049376094707395729073095720753092797490709709707107

Explanation:

Mark as brainliest

Answer Link

Otras preguntas

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
When potassium forms a compound with iodine one electron is transferred from the?
algebra help please?
Buying insurance and investing for the future requires spending less in the present. Why is this a hard choice for many people? Would it be hard for you?
What is the purpose of the terraces as seen in this photograph? A) decoration B) irrigation C) agriculture D) gold mining
Consider the diagram of the Earth, Sun, and Moon system. Which phenomenon is MOST DIRECTLY caused by the revolution of the Earth around the Sun?
How did Spain’s loss of economic power in the 1800s affect life for Filipinos?
A. -30 B. -24 C. -15 D. -6
Which of the following ideas from the Roman Republic is also used in the United States? Leaders create their own government systems Leaders must be of a cert
How is a general partnership organized? only one partner is responsible for the debts of the partnership. no partner is responsible for the debts of the partner