islamoxnata islamoxnata

23-11-2021
Geography

contestada

aidez moi s il vous plait avec cette exercice

aidez moi s il vous plait avec cette exercice class=

Respuesta :

12362502 12362502

24-11-2021

Answer:

Explanation:

number 2

Answer Link

Otras preguntas

When a cell related to immunity activates only in reaction to a specific pathogen, it is called _____. (Points : 4) inducibility clonality lymphocytes T lymphoc

I need help with this. thank you!

What is the source Code of transcription

The deli scale weight meat and cheese in the hundredths of pound Sam put 5/10 pound of pepperoni in the deli scale what does the deli scale show

A parking lot in the shape of a trapezoid has an area of 12,052.1 square meters. The length of one base is 82.4 meters, and the length of the other base is 108.

What does Holden have against bald men?

a dime is flipped and a six-sided die is rolled what is the probability of flipping heads and rolling an odd number

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what other fields of the study might contribute to knowledge and understanding in art history?

Eleven members of the Middle School Math Club each paid the same amount for a guest speaker to talk about problem solving at their math club meeting. They paid