Iamthegayestaround Iamthegayestaround

23-09-2021
History

contestada

10) What where the two apposing view point groups called? -25 points

A) Democrats and Republicans

B) Federalists and Anti-Federalists

C) The North and The South

Respuesta :

ellaevw ellaevw

23-09-2021

Answer:

B)

Explanation:

Im not 100% sure but recently in my history class ive been hearing way more Federalist and Anti-Federalist mentions rather than the new-day terms such as Democrats and Republicans. The North and South should only be referenced in terms of war and things like that.

Answer Link

Otras preguntas

sixty students at gillette road middle school play a winter modified sport. if there are 500 students in the middle school, what percent of students play a spor

client quietly paces in the ed waiting area with his hands on his hips and rubbing his mid-lower left side. he has a flat facial expression. which factor is mos

Can somebody write me a short monolog that is easy you can make it about anything its for my drama class

£2000 is invested in a bank with 3% interest per annum. work out the amount of money in the account after 2 years

Endergonic (energy absorbing) reactions a. Have more energy in the reactants than in the products b. Have more energy in the products than in the reactants c. A

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Chase stole money from a local grocery store to buy beer. He later assaulted a 72-year-old woman and stole her purse because he felt like he needed money more t

Read the topic sentence from asher's analysis of enrique's journey. To demonstrate enrique's intelligence and resourcefulness, nazario depicts his response to t

A representative democracy means the government officials are supposed to?A. Vote in all elections B. Be staunch patriots C. Advocate for authority figures D. S

My dad has been working in KSA ........ Two years.1. From2. For3. since 4. by