sherlin73839 sherlin73839

24-07-2021
Mathematics

contestada

Explain this to me I don't understand

Explain this to me I dont understand class=

Respuesta :

cathy4224fox cathy4224fox

24-07-2021

Answer:

26.124

Step-by-step explanation:

SOH CAH TOA

tan 43 = about 0.933

than times it by 28 and get

26.124

Answer Link

Otras preguntas

What is the source Code of transcription

Help me factor 5x^2-22x-15

what the decimal of 2 1/4

Find the smallest zero for the function h(x) = 4x^2 - 8x - 60

Imagine a situation in which the number of urea leak channels increased dramatically in the ascending limb of the loop of Henle. What could be one likely conseq

which of the following does NOT describe the process of summation? a. Two ESPSs are generated at the same time by two separate synapses, bringing the cell to th

Consider the following formula used to find the volume of a cone. Which of the following represents the formula that could be used to find the height of the con

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Imagine a situation in which the number of urea leak channels increased dramatically in the ascending limb of the loop of Henle. What could be one likely conseq

Describe the fluid theory of intelligence; then explain your views on the theory