RashayL
RashayL RashayL
  • 24-04-2021
  • Biology
contestada

What can mrna do that dna cannot?

What can mrna do that dna cannot class=

Respuesta :

lliana lliana
  • 24-04-2021
mRNA can leave the nucleus while DNA can not
Answer Link
gw3ndolynsky3 gw3ndolynsky3
  • 26-07-2022

Answer: b

Explanation:

Answer Link

Otras preguntas

The author uses the gas station attendants warning to create tension by foreshadowing that.
What is the equation for the line described in #9And #10?
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
who is ur fav lo-fi artist ​
Which best explains the changes in borders shown on these two maps?.
You are driving on a multi-lane municipal road and a bicyclist ahead of you on the right side of the road is signaling to change lanes to the left. You should:_
If you have read “Story of an Hour” by Kate Chopin and “Hills like White Elephants” by Ernest Hemingway…. PLEASE HELP? What would be some similarities and diff
Pls help me with this assignment :I
When prospero and miranda were first exiled, who helped them and how?.
Can you help me explain