27sarabisa 27sarabisa
  • 21-04-2021
  • Physics
contestada

What is the differents between climate and weather

Respuesta :

emilyyang123
emilyyang123 emilyyang123
  • 21-04-2021

weather is short term while climate is over long periods of time.

for example during the winter it is cold which is the climate, but on some days it is warm which is the weather

Answer Link

Otras preguntas

at present prime minister of nepal
What literary term is being used in the italicized lyrics below? i came in *like a wrecking ball*. i never hit so hard in love. All i wanted was to break your
30 POINTS + BRAINLIEST! SHOW ALL WORK PLEASE
What is a start codon?
22. How did the Mongol invasions of Tamerlane and Babur affect Indian culture? A. Buddhist nonviolence ended campaigns of conquest. B. Muslim and Hindu customs
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
Waqas wishes to distribute 128 bananas and also 176 apples equally among a certain number of children. find the highest number of children who can get the fruit
Which of the following statements are true of acids and bases? Check all that apply. A. Bases gain an OH- ion when in a solution. B. Acids add H+ ions to
As we walk, we must make the pledge that we shall march ahead. We cannot turn back. There are those who are asking the devotees of civil rights, "When will you
when does a community undergo succession1. after major ecological changes2 when all its animal life is destroyed3 every few years until it is stable