Melsboys Melsboys

22-11-2016
English

contestada

Identify the italicized word according to its class in structural linguistics.

Respuesta :

maddy1283 maddy1283

27-11-2016

its class is a noun.

Answer Link

Otras preguntas

Which line from this sonnet contains a metaphor? Sometime too hot the eye of heaven shines Thou art more lovely and more temperate Rough winds do shake the darl

Cereal, milk, a banana, and juice create a super ____ meal?

The perimeter of a rectangle is 256 inches. how long are the sides if the length exceeds the width by 16 inches? mark lets x represent the width of the rectangl

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

A man spends $880 in a month. Out of this 26% goes to his rent. How much is his rent?

Most metals are not ? A ductile B good conductors if heat and electric C liquid at room temperature D mellable

Select all that apply. betsie always had a loving response to those who hurt her, and she never showed unkindness. how was this possible, considering her circum

1.The Folsom culture are considered __________ Paleo-Indians who hunted __________. A. archaic . . . bison B. prehistoric . . . mammoths C. early . . . large an

What approach did Jordan take to the Palestinian refugees who fled to Jordan from Israel?

The sine of 58º is equal to the cosine of what angle?