afido91029344 afido91029344
  • 26-02-2021
  • Social Studies
contestada

Why do you think Voltaire's writings were censored?

Respuesta :

asterabarrett5
asterabarrett5 asterabarrett5
  • 26-02-2021

Answer:

The book was originally censored because of the politically sensitive references Swift makes in his novel. "Gulliver's Travels" was also banned in Ireland for being "wicked and obscene." William Makepeace Thackeray said of the book that it was "horrible, shameful, blasphemous, filthy in word, filthy in thought."

Explanation:

Answer Link

Otras preguntas

Is y=x a linear function
while the lophophorate are a all recognized group phylogenic studies do not yet agree on the identity of their closest relatives true or false
DNA tacaggtacccgaacccaattta
Please helpppppppppppppppppppppppppppppppp
what did ernest hemingway say about huckleberry finn and what did he mean by that
Explain how and why scientists classify organisms?
Find the radius of a circle with an area of 78.5 cm2?
What were the political and economic impacts due to the Salem witch trials?
Will is 22​% taller than​ Wanda, so​ Will's height is​ ____% of​ Wanda's height.
Trent How spent 15 minutes at the neighbors house he spent 2/5 of the time swimming how much times did he swim swimming?