a12156 a12156
  • 23-02-2021
  • Mathematics
contestada

Adjust the number into correct standard form.
60 x 103

Respuesta :

devinnn8869
devinnn8869 devinnn8869
  • 23-02-2021
60x+103 if that’s right let me know
Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
plot and steps for writing a comedy please!!!
what type of sentence is used to give a command
what number should be added to the expression to turn it into a perfect square trinomial x^2+2x
A patient comes into the clinic with a resting heart rate of 80 beats per minute (bpm). The patient's cardiac output was found to be 5.6 liters/minute with an e
ex 5 ,,,pleaseeeeeeeeeeeeeee,,,help mee ,,,
why did the united states fail to join the league of nations
Sam has type A blood. Which of the following blood types are NOT at all possible for Sam's offspring? Sam has type A blood. Which of the following blood types a
0-4+7-5×3÷9×5-4 do the sum of that mathematics...
governments may create what to discourage companies from producing negative externalities? Answer choices: benefits, revenues, or regulations