ahmedfatay814
ahmedfatay814 ahmedfatay814
  • 24-01-2021
  • Mathematics
contestada

What is the equation of the line that has a slope of 1/2 and passes through the point (8,-1)? (Write your answer in slope intercept form)​

Respuesta :

darshzibbu darshzibbu
  • 24-01-2021

Answer:

y = 1/2x - 5

Step-by-step explanation:

y = 1/2x+b

-1 = 1/2(8) +b

-1 = 4+b

-5 = b

Answer Link

Otras preguntas

Suggest a reason why food labels provide information about the energy released by the food?
in millions of british pounds how much did germany spend in 1890
Jesse travels 3.0 meters east and then turns and travels 4.0 meters north. What distance did Jesse travel?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
how to find the average range of cells A1:A10
Imagine a situation in which the number of urea leak channels increased dramatically in the ascending limb of the loop of Henle. What could be one likely conseq
I need somebody's help..
PLEASSE HELP ME WITH THIS
Which lines in this excerpt from Mary Otis Warren's poem "A Political Reverie" use figurative language? I look with rapture at the distant dawn , And view the g
What is the source Code of transcription