rakebfanta rakebfanta

22-01-2021
Mathematics

contestada

When plotting points on the coordinate plane below, which point would lie on the y-axis??

Respuesta :

ameliesevest ameliesevest

22-01-2021

Answer:

the second number

Step-by-step explanation:

EX: ( -3, 2 ) the 2 would lie on the y axis because its the second number the x axis always comes 1st and the y axis 2nd

Answer Link

Otras preguntas

Convert 2x - 3y + 1 = 0 to slope-intercept form

Sam left his school at 3:05. He walked at a speed of 3.2 mph. 15 minutes later, Al started running after him, and he caught up with Sam 10 minutes later. What w

write a formula that relates the are A of a triangle to to the lengths of its base b and height h

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Joe has eaten 3/5 of a pizza. Jane has eaten 1/7 of a pizza. How many times more pizza has Joe eaten than Jane in an improper fraction?

Are individuals empowered and do they understand their human rights or when their rights / the rights of others are being violated. Provide FIVE reasons for you

What educational level, age and econimic status of the audience do I reach when talking bout geriatric offices

Which of the following examples would be classified as a dependent clause? A. whirling through the yellow-colored sky B. the mile-wide black tornado roared C.

Family values in Ancient Rome included obedience to elders and devotion to the gods

What might "tangible artifacts" tell us about the Shang?