27aalatwani
27aalatwani 27aalatwani
  • 24-11-2020
  • Mathematics
contestada

PLZ HELP ME IM desperate!!!!
When writing a rebuttal, what is the exact phrasing we use?

Respuesta :

cutliest
cutliest cutliest
  • 24-11-2020

1) Always be polite and professional.

2) Specifically address the points that you disagree with.

3) Provide Evidence.

4) Close with a brief summary of your rebuttal.

Answer Link
s49ih3p44t s49ih3p44t
  • 24-11-2020

Answer:

Although I believe ______, some may think that _______. However (evidence against their claim) shows that (explanation of evidence in 2-3 sentences)

Answer Link

Otras preguntas

Differentate Between Physical and chemical change with 5 example each
What are all Latin script-written languages that use the letter C frequently?
Mrs. Sing invests $12,876 for her business at an annual interest rate of 7 percent for 3 years. Which number will Mrs. Sing substitute for r in the simple inter
Re-read paragraphs 78-88. How does the author build suspense in this section as the boys fight?
Three integers have a mean of 8, a median of 8 and a range of 4.
5. Give the number of significant figures in each of the following. a) 1.05 g b) 0.0003040 mm c) 29000 + 10 ft d) 0.90 x 1045 L e) the number of eggs (12) that
Please solve with explanation
II.- Clocar los números siguientes en la columna que corresponda, tomando en cuenta que se puede repetir en más de una columna. -23, 230i, 0.25, 5236.0252, N Z'
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
2/7 of a number is 6, what is the number?