sadieoshell sadieoshell

22-10-2020
Mathematics

contestada

What is the y-intercept of A line has a slope of -3 and passes through point (-5,4)?

Respuesta :

ethan110904 ethan110904

22-10-2020

Answer:

-11

Step-by-step explanation:

Answer Link

Otras preguntas

what is the answer to -89+11x=3x+98

Oaktree Company purchased new equipment and made the following expenditures: Purchase price $ 59,000 Sales tax 3,600 Freight charges for shipment of equipmen

A ____________ consists of two or more individuals whose beliefs, attitudes, values, norms of behavior, or symbols are used by another person or persons as guid

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq

The Pew Research Center estimates that as of January 2014, 89% of 18-29 year olds in the United States use social networking sites. 1. Calculate the probability

A chemical supply company ships a certain solvent in 10-gallon drums. Let X represent the number of drums ordered by a randomly chosen customer. Assume X has th

How to do Probability in quantities math

Positive statements are not a. prescriptive. b. descriptive. c. made by economists speaking as scientists. d. claims about how the world is.

The following work-in-process inventory information is provided for a company: All direct materials are added at the beginning of the production process. Beginn

Which of the following statements is NOT correct about the phospholipid molecules in the plasma membrane? A. The polar heads face outward. B. The nonpolar tails