isleym36 isleym36
  • 21-10-2020
  • Geography
contestada

The United States _____ Canada’s exports.

Respuesta :

capsasha2
capsasha2 capsasha2
  • 21-10-2020

Answer:

The United States buys almost all of Canada’s exports.

Answer Link

Otras preguntas

What molecule is responsible for determining the fate of each cell
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
The price of a new car is 16000$ Mr Mar paid 15% of the price as a down payment how much does he still owe? (Please help and explain)
A problem play focuses on what exactly? Select all that apply. 1. problems in the author's life 2. problems in society 3. problems in life that haven't yet occ
Who owned the land that is now Florida before it became part of the United States? A. France B. Great Britain C. Spain D. Mexico
:Select the correct text in the passage .Which lines in this excerpt from Phillis Wheatley's poem "Goliath of Gath" contain examples of figurative language? The
A patient received a new heart transplant, but shows signs of graft rejection after 2 weeks. Which type of hypersensitivity reaction is in progress?" a) Type I
find the amount of the discount on a $234 item with a discount of 15% A. $35.01 B. $40.00 C. $23.40 D. $35.10
jon eat 3/4 of a pizza how much pizza is left
What event takes place in the second entry of Anne Frank's dairy?