lizbethsoils22 lizbethsoils22
  • 24-09-2020
  • Mathematics
contestada

Find the area of the figure. (Sides meet at right angles.)
5 cm
5 cm
3 cm
B cm
5 cm
5 cm
5 cm
15 cm

Find the area of the figure Sides meet at right angles 5 cm 5 cm 3 cm B cm 5 cm 5 cm 5 cm 15 cm class=

Respuesta :

fionaferlich1
fionaferlich1 fionaferlich1
  • 24-09-2020

Answer:

60 cm

Step-by-step explanation:

there's alot of ways you can split up the shape but

15x2=30

5x3=15

5x3=15

30+15+15=60

Answer Link
rharris17
rharris17 rharris17
  • 24-09-2020

Answer:

60 cm²

Step-by-step explanation:

divide the shape into smaller shapes, calculate the area for those small shapes, and then add them up.

Ver imagen rharris17
Answer Link

Otras preguntas

Mental set and functional fixedness are two types of
x= a) 115.5 b) 137 c) 180
What’s the correct answer?
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
At what wind speed does a tropical storm become a hurricane?
Hiro was using the database to prepare information for a presentation to potential investors. Which tool is he likely to use? A. Forms B. Sorts C. Que
Immune system cells enter a resting phase after undergoing mitosis. when activated—for example, by an infection—they can reenter the sequence of events in the c
"if a six sided dice is rolled 2 times. what is the probability of obtaining a 2"
find the value of Y and explanation please
Receiving realistic training, understanding the types of situations encountered in war, eating well, getting enough rest, and having meaningful relationships an