montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

A cylinder has a height of 7 feet and a volume of 2200 cubic feet. What is the radius of the cylinder? Use 22/7 as an approximation of π . Simplify your an

B. Write the rule for the nth term of the geometric sequence given one term and common ratio. 5) a2 = = 6 r = 2 6) a = 75 r = 5

Complete the sentences by giving a possible cause.i have sprained my ankle____________________

Can somebody help me please?! Graph the image of square JKLM after a reflection over the line x= -1 If you don’t know math don’t try to answer this if you don’t

Why was abundant rivers an advantage for great britain during the time of its industral revolution?

Calculate the temporary hardness and permanent hardness of a sample of water containing: Mg(HCO₃)₂ = 7.3 mg/l; Ca(HCO₃)₂ = 16.2 mg/l; MgCl₂ = 9.5 mg/l; CaSO₄ =

Long-term investment decision, payback method Bill Williams has the opportunity to invest in project A that costs $9,000 today and promises to pay annual end-of

julie ann williams would like to find the probability that her project will be finished on or before the 16-week earth day deadline.

which question is important for a nurse to ask a patient taking tigan

Find the equation of the regression line for the following data set.Y =X 5 6 7Y 7 6 5