lutherrstarr lutherrstarr

24-07-2020
History

contestada

Was government aid enough to help Americans during the Great Depression?

Respuesta :

WhyJoseFeen WhyJoseFeen

24-07-2020

Answer:

Yes And No

Explanation:

Well as you might know FDR set up many programs that helped the American people But you also had unions and Etc and also WW2

Answer Link

Otras preguntas

Lines AB and CD are parallel. If 26 measures (4x - 34), and 28 measures 106°, what is the value of x? A. x = 17 B. x=254 C. x=27 D. x= 106

Antonia is purchasing a house for $210,000, with a 15-year fixed-rate mortgage at 4.75% interest. She has made a 5% down payment. The house is valued at $205,00

Henry ordered 12 sub sandwiches for $65.55 How much did each sandwich cost?

What effects did the revolution have on women, Loyalists, and African Americans?

Which of the following is not a quadratic function

que características tiene una economía agraria

The width of a square tablecloth is 8 feet. What is the area of the tablecloth?

What type of transformation moved the pre-image to this image?

_____________are opposite angles that share the same vertex. They are formed by a pair of intersecting lines. Their angle measures are equal.

transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC