madisonrandle1190 madisonrandle1190
  • 26-04-2020
  • Mathematics
contestada

New York City has 8.38.38, point, 3 million people and an area of 1200 km. Tokyo has 13.2 million people and an area of 2200km Which city has a greater population density?

Respuesta :

alisyahbryin6 alisyahbryin6
  • 26-04-2020
Sdhbcaabb scvbv 143
Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Lee used her computer for 60 minutes on Friday. On Saturday, she used her computer for 150% of the number of minutes she used it on Friday. What was the number
Water and minerals can follow three pathways to the vascular tissue of the root. Describe the three pathways.
why were mountain men moving west
what process releases the least atp per molecule of glucose for immediate cell use?
When is cash pulled out of circulation
Pseudomonas syringae is found naturally in the soil. Sold as Snomax, it is used to make snow at ski resorts. The same bacterium with a gene deletion (Ice-minus)
In a Worn path by Eudora welty in lines 1-9 what details suggest that phoenix is in for a long journey?
Explain the importance of spore formation for both eukaryotes and prokaryotes.
Which is an example of a plant with true roots? A) algae B) ferns C) liverworts D) moss