luvxmimi luvxmimi
  • 23-04-2020
  • Biology
contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​

Respuesta :

Аноним Аноним
  • 23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link
StephanyNo StephanyNo
  • 23-04-2020
AUGGGUAAUGCGCCGUUCGCAUUAAUG
Answer Link

Otras preguntas

i raise up my voice not so that i can shout but so that those without a voice can be heard we cannot succeed when half of us are held back By Malala Yousafzai
Select all input values for which g(x) = 8.Choose all answers that applyA. x=-4B. x=6C. x=9D. None of the above​
Which word best describes the tone of the excerpt? A. mocking B. frustrated C. mysterious D. troubled
What is the dollar value of 2 pennies and 3 dimes? What is the dollar value of pp pennies and dd dimes?
Please help! Thank you!!
i will give one hundred points and brainliest for the person that answers this correctly One is to three as three is to five and five is to four and four is th
Whose bag is this?i don't know but it belong to goda
who is george stephenson​
what is the value of X, 2x+19 x+23
A group of ecosystems with similar abiotic and biotic features Biome Climate Emergent Layer Deciduous