sofiabernal8 sofiabernal8

22-04-2020
Mathematics

contestada

Which point on the graph shows the reflection of point A across the y-axis?

Which point on the graph shows the reflection of point A across the yaxis class=

Respuesta :

keirazenizumi1008 keirazenizumi1008

22-04-2020

Answer:

point t

Step-by-step explanation:

to reflect over the y-axis, flip the sign of the x coordinate

(6, -4) to (-6, -4)

point t is located at (-6,-4)

Answer Link

Otras preguntas

how are the four earths systems connected

how did Thomas Edison contribute to the Industrial Revolution

which of the following are examples of ways humans and plants have coevolved? Pick all that apply A. Humans have bred plants to use as food B. Plants provide a

Discuss at least two effects on U.S. citizens that stem from the division of power between the federal and state governments.

only question 4 thank you

Glucose derivatives can produce a number of different molecules, including sugar acids. Below are three sugar acids. (1) Indicate which carbon has been oxidized

what is 0+50×1-60×0+10=

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what came first the chicken or the egg

Look At The Picture. Thats The Question I Need Answered ASAP