chaudhrymaimoonah
chaudhrymaimoonah chaudhrymaimoonah
  • 22-04-2020
  • Biology
contestada

What part of the brain develops slower than the limbic system?

Respuesta :

kritika3375
kritika3375 kritika3375
  • 22-04-2020

Answer:

Rational part of the brain develops slower than the limbic system.

Hope it will help ^_^

Answer Link
chappie693
chappie693 chappie693
  • 22-04-2020

prefrontal cortex Doesn’t develop fully until your 30-40s

Answer Link

Otras preguntas

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
What’s the percent on manslaughters are due to alcohol
What is the missing term, x, in the pattern? –2, x, –50, 250, –1250 Urgent!!
A combination lock has 40 numbers on it. How many different 3-digit lock combinations are possible if no digit can be repeated?
_____ involves identifying and thinking about the fundamental questions of human entity
I need to know what this says
While shopping for prom, I found amazing heels covered in gold sequins. Which type of sentence structure is used in the above sentence? A. compound sentence B.
How do natural actions such as weathering, erosion, and soil formation affect Earth's surface?
[OU.01] The light from Andromeda galaxy takes about 2.6 million years to reach Earth. Which of these statements is correct about the Andromeda galaxy?
A 12.82 g sample of a compound contains 4.09 g potassium (K), 3.71 g chlorine (Cl), and oxygen (O). Calculate the empirical formula.