jdilan73
jdilan73 jdilan73
  • 24-03-2020
  • Mathematics
contestada

if you have 5 apples on 1 branch how many are there on 5 branches?

Respuesta :

joshmcs07 joshmcs07
  • 24-03-2020

Answer: 25 apples

Step-by-step explanation: because 5 apples times 5 branches is 25

Answer Link
Аноним Аноним
  • 24-03-2020

Answer:

1st branch = 5

2nd branch =5

3rd branch =5

4th branch = 5

5th branch =5

if u add it all up you get 25 and that's your answer

another simpler way is to say 5 multiplied by 5 = 25.

Hope it helps:)

Step-by-step explanation:

Answer Link

Otras preguntas

Pamela: ¿Qué te aconsejó el médico para el dolor de tu rodilla? Ricardo: Me aconsejó tomar _____________________. A. unos analgésicos B. una cir
Write Six million seven hundred thousand, twenty in standard form
2/3•1/8 what’s the simplified version
What are the four forms of energy can be found in?
60 is what percent of 145
Help I don’t really understand this
Jerry's parents have legally ended their marriage. This is known as
Find 1/2 of 5 less than 10
Which are characteristics of the yellow journalism? Check all that apply. •Sensational language •Well-supported, fact-based arguments •exaggeration •eye-catc
DNA tacaggtacccgaacccaattta