kj92961 kj92961
  • 24-03-2020
  • Mathematics
contestada

What is the greatest perfect square that is a factor of 150

Respuesta :

moejenningsjr123
moejenningsjr123 moejenningsjr123
  • 24-03-2020

Answer:

Answer : 1,2,3,5,6,10,15,25,30,50,75,150, Related Links : Is 150 a rational number?

Step-by-step explanation:

The factors of 150.

Answer Link
gshreya2005
gshreya2005 gshreya2005
  • 24-03-2020

Answer:

6

Step-by-step explanation:

Check the perfect squares until you find one or get past half of the number (150).

4,9,16,25

25 is a perfect square

25*?=150

25*6=150

pls mark me brainiest

Answer Link

Otras preguntas

DNA tacaggtacccgaacccaattta
what is the solution of |3x+9|≤15 answer choices v
Tia cut a 4 meter 8 centimeter wire into 10 equal pieces. Martha cut 540 centimeter wire into 9 equal pieces. how much longer is one of Martha's wires tha
Every day, a group of 9 workers picks pea pods in a field. Each worker picks 240 pea pods, and each pea pod contains 6 peas. How many peas do the workers pick e
Match the vocabulary word with its meaning. 1. chattel one of the ordinary citizens of Rome 2. patrician philosophy that attempts to combine different syste
Find the value of y. 8 16 8sqrt3 4sqrt3
Read the following passage from Lincoln's "Gettysburg Address." Now we are engaged in a great civil war, testing whether that nation, or any nation so conceived
How did Marco Polo impact relations between Europe and China
What is the name of the drawing area in Inkscape?What is the name of the drawing area in Inkscape?
Write the inequality for the graph