xavierharris2345 xavierharris2345

22-02-2020
Mathematics

contestada

Use Pythagorean’s theorem to find x

Respuesta :

imaanahamed78 imaanahamed78

22-02-2020

Answer:

Whats the actual values?

Step-by-step explanation:

Answer Link

Otras preguntas

Which group of people did Francisco pizzaro conquer A) Incas B) herons C) Aztecs D) Dakota

IM ON A TIMER! PLZZZ HELP Read the excerpt from Emily Dickinson’s “I’m Nobody! Who Are You?” Which two lines have a rhyming pattern? How dreary—to be—Somebo

How do rivers become larger as they travel across land? Groundwater rises, adding water to rivers. Tributaries combine, adding water to rivers. Ice sheets m

Leonardo da Vinci’s use of composition in his paintings was influenced by what other Renaissance artists? A. Van der Weyden B. Raphael C. Botticelli D. Michelan

DNA tacaggtacccgaacccaattta

What is the slog for 10

Read the sentence. Marcus threw the baseball to his teammate. Which best identifies the voice verb in this sentence? ⬆️⬆️VIEW PICTURE ABOVE⬆️⬆️

The demand for luxury goods is highly

The perimeter of a scalene triangle is 14.5cm. The longest side is twice that of the shortest side. Which equation can be used to find the side lengths if the l

Can a balanced force move?