ForgivenSins
ForgivenSins ForgivenSins
  • 24-11-2019
  • Mathematics
contestada

Please help I will give as much points as I can and brainliest

Please help I will give as much points as I can and brainliest class=

Respuesta :

drewm05
drewm05 drewm05
  • 24-11-2019
You would times 2/15 by 3. Then getting 6/15, simplify the fraction by dividing both numbers by 3. You would finally get 2/5 which is C. Hope this helps!
Answer Link

Otras preguntas

Which do the enzymes do? A Chemical Digestion B Mechanical Digestion
Please helpppp!!!! Is this correct and do I put a space in between the number and the =?
What length is the base of the triangle?
Janice bought 3 hamburgers and 4 hotdogs for her cousins and paid $8.50. Brian bought 3 hamburgers and 6 hotdogs for his cousins and paid $10.50. How much did o
5. A student wants to know how tall the flagpole at her school is, her eye level is 5.5 feet above the ground and she stands 36 feet from the base of the flagpo
what do you think of my oc
please helpp!!!You are stuck in a big traffic jam on the freeway and you are wondering how long it will take to get to the next exit, which is miles away. You a
⚠️⚠️⚠️⚠️help⚠️⚠️⚠️⚠️​
Make sure answer is correct and please explain answer no random websites, they will get reported
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT