hfz hfz
  • 25-08-2019
  • Geography
contestada

the purpose of domestic waste​

Respuesta :

fareed10 fareed10
  • 25-08-2019

.

Solid waste comprising of garbage and rubbish (such as bottles, cans, clothing, compost, disposables, food packaging, food scraps, newspapers and magazines, and yard trimmings) that originates from private homes or apartments. ... Also called domestic waste or residential waste.

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
The spread of ideas during the Renaissance was MOST affected by. A) luthers religious conversion. B) the support of the Catho
How are glial cells and neurons alike and how are they different. Give 3 sentences for each
Pedro tapes a 3 5/6 piece of paper to a 2 3/4 inch of piece with no overlap. how long is the piece of paper he made?
explain the conditions for cloud formation
Dr. Potter provides vaccinations against polio and measles. Each polio vaccination multi-dose vial consists of 44 individual doses, and each measles vaccination
what do you think accounts for algerias score it has received in recent years on government stability and the absence of violence
Are individuals empowered and do they understand their human rights or when their rights / the rights of others are being violated. Provide FIVE reasons for you
what is the solution to the following equation? 9x^2-12x+4=17
How can one concentrate in studies ?