khaledkharboush khaledkharboush

22-06-2019
English

contestada

2. Which of the following literary elements are NOT included in structure?

Theme

Dialogue

Setting

Plot

Respuesta :

Аноним Аноним

22-06-2019

the literary element that is not included in structure is dialogue.

Answer Link

livybbyxoxo livybbyxoxo

23-06-2019

your answer is the first option! Theme

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What do they mean when they say, "Society pays for the end results of alcohol abuse"? Do they mean that the person who consumed it pays the consequences or lite

A machine drops 74 milliliters of liquid into a beaker every minute. Using an empty beaker, Sarah started the machine and left the room. When she returned, the

Which is an example of a plant with true roots? A) algae B) ferns C) liverworts D) moss

I need help please what are some negative effects of stress on an individual? For this discussion, I would like everyone to explain how stress affects an indivi

How many times dose 63 go into 359

While the signalman is describing the actions of the person he sees by the mouth of the tunnel, the narrator says in his mind. "for God's sake clear the way!" w

How do short-term goals differ from long-term goals?

Please help me answer these questions

Use these words in a sentence proton neutron and isotope