dmvprince dmvprince

26-01-2019
Mathematics

contestada

use the order of operations to evaluate 5+4×2

Respuesta :

jimrgrant1 jimrgrant1

26-01-2019

Answer:

13

Step-by-step explanation:

multiplication is performed before addition

5 + 8 ← performing multiplication

= 13 ← performing addition

Answer Link

amberwithnell12512 amberwithnell12512

26-01-2019

Answer:

It would be 18.

Step-by-step explanation:

5+4=9

9x2=18

Answer Link

Otras preguntas

what is 1⅗ as a fraction greater than one?

Choose the two sentences that use a dash appropriately. Answer choices for the above question THIS IS LANGUAGE ARTS A. My aunt will—arrive tomorrow. B. My dad—a

What events led to the downfall of the Federalist Party and the election of Democratic-Republican Thomas Jefferson in 1800 election?

Explain two ways the anaconda plan helped the Union win the war?

pls help im cryyyy!!! ;(

Which statement is a main idea of ""The Most Famous Woman in America""?

NO LINKS AND NO FAKE ANSWERS . Describe two ways that seeds are dispersed?

How does Reynolds's truth-telling about Thomas Jefferson compare to narratives typically told about him as one of our nation's founding fathers?

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

Write the common noun and proper noun in each sentence? Edison patented over one thousand inventions Where did the busy inventor work in America The laboratory