roberdsa79pbzfjz roberdsa79pbzfjz

22-09-2018
Business

contestada

Select all that apply.

_____ is an example of a postsecondary degree.

Master's
Bachelor's
Associate's
Specialist's

Respuesta :

roxypdiisi roxypdiisi

22-09-2018

I'm pretty sure all of them are post-secondary degrees. Let me know if i'm incorrect.

Answer Link

ellifant2016 ellifant2016

22-09-2018

All of the above I think, it has to be after secondary School or highschool

Answer Link

Otras preguntas

For each charity donation made by an employee of Tillman Corporation, the company will contribute an additional 40% of the amount. Last month, Tillman donated

What are condoms used for

tell whether the sequence is arithmetic .If it identify the common diffrence. -7,-3,1,5 1) not arithmetic 2) Arithmetic, common difference is 4 3) Arithmetic, c

does bone strenght require performance-related fitness or non-performace-related fitness?

the writing the ancient egyptians used is called

Which of the following is NOT typically a stressor? —————————————————————————— Going for a walk ————————— Missing the bus ———————— A fire alarm blaring ——

the y-intercept is the point where the graph crosses the __ axis

. Compare and contrast American expansion (growth) in the late 1800's with expansion in the 1900's. (Identify how the expansion efforts were the same and how th

the sum of three consecutive even integers is 258. write an equation ad solve to find the integers

DNA tacaggtacccgaacccaattta