roberdsa79pbzfjz
roberdsa79pbzfjz roberdsa79pbzfjz
  • 22-09-2018
  • Business
contestada

Select all that apply.

_____ is an example of a postsecondary degree.

Master's
Bachelor's
Associate's
Specialist's

Respuesta :

roxypdiisi roxypdiisi
  • 22-09-2018

I'm pretty sure all of them are post-secondary degrees. Let me know if i'm incorrect.

Answer Link
ellifant2016
ellifant2016 ellifant2016
  • 22-09-2018
All of the above I think, it has to be after secondary School or highschool
Answer Link

Otras preguntas

For each charity donation made by an employee of Tillman Corporation, the company will contribute an additional 40% of the amount. Last month, Tillman donated
What are condoms used for
tell whether the sequence is arithmetic .If it identify the common diffrence. -7,-3,1,5 1) not arithmetic 2) Arithmetic, common difference is 4 3) Arithmetic, c
does bone strenght require performance-related fitness or non-performace-related fitness?
the writing the ancient egyptians used is called
Which of the following is NOT typically a stressor? —————————————————————————— Going for a walk ————————— Missing the bus ———————— A fire alarm blaring ——
the y-intercept is the point where the graph crosses the __ axis
. Compare and contrast American expansion (growth) in the late 1800's with expansion in the 1900's. (Identify how the expansion efforts were the same and how th
the sum of three consecutive even integers is 258. write an equation ad solve to find the integers
DNA tacaggtacccgaacccaattta