jojo409692 jojo409692
  • 23-08-2018
  • History
contestada

What is one way US workers are effected when jobs are outsourced to less-developed countries?

Respuesta :

destinyforrest4
destinyforrest4 destinyforrest4
  • 23-08-2018
One way US workers are affected when jobs are outsourced to less-developed countries is that workers in foregin countries do US workers' job for less money
Answer Link

Otras preguntas

Kohlberg believed that human moral development is strongly based on the fact that we all have a desire for justice and a(n) __________. A. impartiality for fair
f(x)= 3/x+2-square root x-3
Why wood suitable to build boats and rafts
Can someone help me with this problem... #20
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Helena needs 3.5 cups of flour per loaf of bread and 2.5 cups of flour per batch of muffins. She also needs 0.75 cup of sugar per loaf of bread and 0.75 cup of
what procedure could you use to test the effect of a catalyst on a reaction
Who is Christina LeConte
1+4=5 2+5=12 3+6=21 8+11=
Which lines in this excerpt from Mary Otis Warren's poem "A Political Reverie" use figurative language? I look with rapture at the distant dawn , And view the g