yasiiii yasiiii
  • 24-06-2018
  • Physics
contestada

Is it correct that transport phenomenon only occure in gass and liquid state?

Respuesta :

Salubhai254
Salubhai254 Salubhai254
  • 24-06-2018
I think the answer is yes
Answer Link

Otras preguntas

what came first the chicken or the egg
Please help me with this question
plot and steps for writing a comedy please!!!
the volume of a sphere is 950 cubic inches. Use the formula for the volume of a sphere to find the radius to the nearest tenth of an inch
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
in a beauty contest, half of the judges voted for miss.a .2\3 of them voted for miss.b., 10 voted for both and 6 did not vote for either miss.a or miss.b.find h
Juliana’s exercise partner is running a high fever and feels nauseous. She also has a rapid heart rate. What should Juliana do? Get warm food Stay in the sun
Consider the following formula used to find the volume of a cone. Which of the following represents the formula that could be used to find the height of the con
one reason President Johnson created the Great Society program was to
how to get the answer to this equation 1+4=5 2+5=12 3+6=21 8+11=?