valerie2027posada valerie2027posada

24-04-2024
Biology

contestada

Codons
Which amino acids does this mRNA strand code for?
You must spell out the entire name of the amino acid

5'CCGGAUGUCCGUAUAACGGC3'

Respuesta :

Otras preguntas

Hey y’all! I don’t understand this and maybe you guys could help me cuz...ya know that’s what this sight is for...haha. This is the Solving One-Step Inequalitie

What is the overall order of reaction for this rate law: Rate = k ? A. zero B. first C. second D. third

Please help with this

A steel oil tank is a cylinder with a diameter of 12 ft and a height of 18 ft. How many square feet of steel were needed to make the tank

which conditions describe the neritic zone? check all that apply few organisms ample sunlight changing salinity frigid temps steady nutrient supply

Which of the following caused the most conflict within Russia after the end of the Cold War? A. Ethnic revelries led to armed conflict in Kosovo B. Russia ma

Triangle and triangle are similar. What is the measure of side ?

Glucose enters the epithelial cells of the small intestine against its concentration gradient. Select the BEST explanation from the following. Glucose is co-tra

What is the period of the graphed function? A. π B. 0.75 C. 2 π D. π/2 E. -0.75

A 45 kg ice skater at rest caught a 0.25kg ball, If the ice skater moved at 0.15 m/s after catching the ball, find the speed of the ball before he caught it.