kaanan8459 kaanan8459
  • 22-05-2023
  • Biology
contestada

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3'

Respuesta :

Otras preguntas

AP CHEM answer and i will give brainliest, image attached
PLS HURRY! WILL MARK BRAINLIEST A banner is made of a square amd a semicircle. The square has side lengths of 26 inches. One side of the square is also the diam
What is the BEST way, if any, to rewrite Sentence (18)? es A) Leave as is. B) You are probably wondering how all of the rules and their exceptions you will ever
Which unit could be used to measure the capacity of a kitchen pot? O a) kilograms b) quarts c) pounds​
Define the following: 1. Allocation of resources 2. Economic system 3. Market economy
Find, from first principle the derivative of 1/x^2+1 with respect to x.​
Who was the unknown sahabi?
What is the mode of the teachers' ages?
…. I need help again oof
The times taken to assemble a clock at a factory are approximately normally distributed with a given mean Mu = 3 hr and standard deviation Sigma = 0.5 hr. What