kaanan8459 kaanan8459

22-05-2023
Biology

contestada

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3'

Respuesta :

Otras preguntas

AP CHEM answer and i will give brainliest, image attached

PLS HURRY! WILL MARK BRAINLIEST A banner is made of a square amd a semicircle. The square has side lengths of 26 inches. One side of the square is also the diam

What is the BEST way, if any, to rewrite Sentence (18)? es A) Leave as is. B) You are probably wondering how all of the rules and their exceptions you will ever

Which unit could be used to measure the capacity of a kitchen pot? O a) kilograms b) quarts c) pounds

Define the following: 1. Allocation of resources 2. Economic system 3. Market economy

Find, from first principle the derivative of 1/x^2+1 with respect to x.

Who was the unknown sahabi?

What is the mode of the teachers' ages?

…. I need help again oof

The times taken to assemble a clock at a factory are approximately normally distributed with a given mean Mu = 3 hr and standard deviation Sigma = 0.5 hr. What